Stem-loop sequence dpu-mir-285

AccessionMI0012237 (change log)
DescriptionDaphnia pulex miR-285 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --acagagg   ug  -auc          uu  a   c    -- g       
5'          agc  gg    acugaauucu  ug ugc uaga  u uaguuu 
            |||  ||    ||||||||||  || ||| ||||  | ||||| g
3'          ucg  cc    ugacuuaagg  ac acg aucu  a aucagu 
   uuaacgcgg   gu  cauu          uu  c   -    ca g       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (V1.0; GCA_000187875.1) Overlapping transcripts
GL732523.1: 332494-332594 [+]
intergenic
Database links

Mature sequence dpu-miR-285

Accession MIMAT0012656
Sequence

62 - 

uagcaccauuggaauucaguuu

 - 83

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).