Stem-loop sequence dpu-mir-281

AccessionMI0012236 (change log)
DescriptionDaphnia pulex miR-281 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   agagcuuga -   c         -ua       a    -augcug  u 
5'          g ccg aaagagagc   uccguga cagu       ug g
            | ||| |||||||||   ||||||| ||||       ||  
3'          c ggu uuucucucg   agguacu guca       gc u
   --------a a   a         ucg       -    cuuaaaa  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (V1.0; GCA_000187875.1) Overlapping transcripts
GL732533.1: 1065344-1065431 [-]
intergenic
Database links

Mature sequence dpu-miR-281

Accession MIMAT0012655
Sequence

61 - 

ugucauggagcugcucucuuuau

 - 83

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).