Stem-loop sequence dpu-mir-279a

AccessionMI0012235 (change log)
Previous IDsdpu-mir-279
DescriptionDaphnia pulex miR-279 stem-loop
Gene family MIPF0000184; mir-279
Literature search

1 open access papers mention dpu-mir-279a
(1 sentences)

Stem-loop
   ----------------------------------       c   uuaacuu    ugg     g   uga 
5'                                   ucugguc aug       gauu   cgacc aac   a
                                     ||||||| |||       ||||   ||||| |||    
3'                                   agaucag uac       uuaa   guugg uug   a
   gcuuaaugguugacacagugaccuacucacaccu       -   ------u    -ua     -   uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (V1.0; GCA_000187875.1) Overlapping transcripts
GL732585.1: 523633-523733 [-]
intergenic
Database links

Mature sequence dpu-miR-279a

Accession MIMAT0012654
Previous IDsdpu-miR-279
Sequence

60 - 

ugacuagauccacacucaucca

 - 81

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).