miRNA Entry for MI0012220

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.

mir-124 microRNA precursor family

Predicted secondary structure and sequence conservation of mir-124
Identifiers
Symbol	mir-124
Rfam	RF00239
miRBase	MI0000443
miRBase family	MIPF0000021
Other data
RNA type	Gene; miRNA
Domain(s)	Eukaryota
GO	0035195 0035068
SO	0001244

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373),^[1] nematode worms (MI0000302),^[2] mouse (MI0000150) and human (MI0000443).^[3] The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.^[4]

[edit] Targets of miR-124

Visvanathan et al.. showed that miR-124 targets the mRNA of the anti-neural function protein SCP1 (small C-terminal domain phosphatase 1).^[5]

Makeyev et al. showed that miR-124 directly targets PTBP1 (PTB/hnRNP I) mRNA, which encodes a global repressor of alternative pre-mRNA splicing in non-neuronal cells.^[6]

[edit] References

^ Lai, EC; Tomancak P, Williams RW, Rubin GM (2003). "Computational identification of Drosophila microRNA genes". Genome Biol 4 (7): R42–. doi:10.1186/gb-2003-4-7-r42. PMC 193629. PMID 12844358. //www.ncbi.nlm.nih.gov/pmc/articles/PMC193629/.
^ Lim, LP; Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP (2003). "The microRNAs of Caenorhabditis elegans". Genes Dev 17 (8): 991–1008. doi:10.1101/gad.1074403. PMC 196042. PMID 12672692. //www.ncbi.nlm.nih.gov/pmc/articles/PMC196042/.
^ Lagos-Quintana, M; Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T (2002). "Identification of tissue-specific microRNAs from mouse". Curr Biol 12 (9): 735–739. doi:10.1016/S0960-9822(02)00809-6. PMID 12007417.
^ Cao X, Pfaff SL, Gage FH (2007). "A functional study of miR-124 in the developing neural tube". Genes Dev. 21 (5): 531–6. doi:10.1101/gad.1519207. PMC 1820895. PMID 17344415. //www.ncbi.nlm.nih.gov/pmc/articles/PMC1820895/.
^ Visvanathan J, Lee S, Lee B, Lee JW, Lee SK (2007). "The microRNA miR-124 antagonizes the anti-neural REST/SCP1 pathway during embryonic CNS development". Genes Dev. 21 (7): 744–9. doi:10.1101/gad.1519107. PMC 1838526. PMID 17403776. //www.ncbi.nlm.nih.gov/pmc/articles/PMC1838526/.
^ Makeyev EV, Zhang J, Carrasco MA, Maniatis T (August 2007). "The MicroRNA miR-124 Promotes Neuronal Differentiation by Triggering Brain-Specific Alternative Pre-mRNA Splicing". Mol. Cell 27 (3): 435–48. doi:10.1016/j.molcel.2007.07.015. PMC 3139456. PMID 17679093. //www.ncbi.nlm.nih.gov/pmc/articles/PMC3139456/.

[edit] External links

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

This molecular or cell biology article is a stub. You can help Wikipedia by expanding it.

Mature sequence dpu-miR-124
Accession	MIMAT0012639
Sequence	61 - uaaggcacgcggugaaugccaag - 83 Get sequence
Evidence	not experimental

References
1	PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).

miRBase

Stem-loop sequence dpu-mir-124

[edit] Targets of miR-124

[edit] References

[edit] External links

Mature sequence dpu-miR-124

References