Stem-loop sequence dpu-bantam

AccessionMI0012215 (change log)
DescriptionDaphnia pulex bantam stem-loop
Gene family MIPF0000153; bantam
Literature search

2 open access papers mention dpu-bantam
(2 sentences)

Stem-loop
   ----uc    uuuaaa  u     c        u         gc    u   a 
5'       ggcu      cc cgaga uaguuuuc cagugaucu  caga auu u
         ||||      || ||||| |||||||| |||||||||  |||| ||| u
3'       ccga      gg guuuu gucgaaag guuacuaga  gucu uaa u
   ucagcu    ----ua  u     a        u         --    u   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (V1.0; GCA_000187875.1) Overlapping transcripts
GL732637.1: 370149-370249 [+]
intergenic
Database links

Mature sequence dpu-bantam

Accession MIMAT0012634
Sequence

61 - 

ugagaucauugugaaagcugauu

 - 83

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).