Stem-loop sequence bta-mir-542

AccessionMI0012214 (change log)
DescriptionBos taurus miR-542 stem-loop
Gene family MIPF0000185; mir-542
Literature search

4 open access papers mention bta-mir-542
(6 sentences)

Stem-loop
   --au  aca ac       auc    gg    uca         -a   c 
5'     gc   g  cucagac   ucgg  auca   ugucacgag  uac a
       ||   |  |||||||   ||||  ||||   |||||||||  |||  
3'     cg   c  gggucug   aguc  uagu   acaguguuc  gug c
   uacu  --c ga       gaa    aa    uag         ac   u 
Get sequence
Deep sequencing
11173 reads, 11.9 reads per million, 67 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 18283105-18283201 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-542
bta-mir-424chrX: 18288411-18288506 [-]
bta-mir-503chrX: 18288067-18288149 [-]
bta-mir-3601chrX: 18283115-18283192 [+]
bta-mir-542chrX: 18283105-18283201 [-]
bta-mir-450a-2chrX: 18282193-18282284 [-]
bta-mir-450a-1chrX: 18282042-18282123 [-]
bta-mir-450bchrX: 18281872-18281957 [-]
Database links

Mature sequence bta-miR-542-5p

Accession MIMAT0013594
Sequence

21 - 

ucggggaucaucaugucacgag

 - 42

Get sequence
Deep sequencing620 reads, 64 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

References

1
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).