Stem-loop sequence bta-mir-450a-1

AccessionMI0012213 (change log)
Previous IDsbta-mir-450-1
DescriptionBos taurus miR-450a-1 stem-loop
Gene family MIPF0000128; mir-450
Literature search

5 open access papers mention bta-mir-450a-1
(7 sentences)

Stem-loop
   -----------------     uuu     u              cag 
5'                  acuau   ugcga guguuccuaauaug   u
                    |||||   ||||| ||||||||||||||   a
3'                  uggua   acguu uacgaggguuauau   u
   gacauauaacuauguuu     cgu     u              aaa 
Get sequence
Deep sequencing
5209 reads, 7.25 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 18282042-18282123 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-450a-1
bta-mir-424chrX: 18288411-18288506 [-]
bta-mir-503chrX: 18288067-18288149 [-]
bta-mir-3601chrX: 18283115-18283192 [+]
bta-mir-542chrX: 18283105-18283201 [-]
bta-mir-450a-2chrX: 18282193-18282284 [-]
bta-mir-450a-1chrX: 18282042-18282123 [-]
bta-mir-450bchrX: 18281872-18281957 [-]
Database links

Mature sequence bta-miR-450a

Accession MIMAT0003834
Previous IDsbta-miR-450
Sequence

6 - 

uuuugcgauguguuccuaauau

 - 27

Get sequence
Deep sequencing10304 reads, 69 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).