Stem-loop sequence bta-mir-424

AccessionMI0012212 (change log)
DescriptionBos taurus miR-424 stem-loop
Gene family MIPF0000164; mir-322
Literature search

11 open access papers mention bta-mir-424
(114 sentences)

Stem-loop
   ucguuga   -       a  c      aa             g  cu 
5'        cuc cgagggg ug agcagc  uucauguuuugaa ug  u
          ||| ||||||| || ||||||  ||||||||||||| ||  u
3'        gag guucccc au ucgucg  gagugcaaaacuu gc  a
   --ugaag   c       c  a      cg             g  aa 
Get sequence
Deep sequencing
8177 reads, 25 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 18288411-18288506 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-424
bta-mir-424chrX: 18288411-18288506 [-]
bta-mir-503chrX: 18288067-18288149 [-]
bta-mir-3601chrX: 18283115-18283192 [+]
bta-mir-542chrX: 18283105-18283201 [-]
bta-mir-450a-2chrX: 18282193-18282284 [-]
bta-mir-450a-1chrX: 18282042-18282123 [-]
bta-mir-450bchrX: 18281872-18281957 [-]
Database links

Mature sequence bta-miR-424-5p

Accession MIMAT0013593
Previous IDsbta-miR-424
Sequence

21 - 

cagcagcaauucauguuuuga

 - 41

Get sequence
Deep sequencing7284 reads, 68 experiments
Evidence experimental; cloned [2], Illumina [3]
Predicted targets

Mature sequence bta-miR-424-3p

Accession MIMAT0015304
Previous IDsbta-miR-424*
Sequence

58 - 

caaaacgugaggcgcugcuau

 - 78

Get sequence
Deep sequencing892 reads, 60 experiments
Evidence experimental; cloned [1-2], Illumina [3]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
3
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).