Stem-loop sequence bta-mir-19b-2

AccessionMI0012209 (change log)
DescriptionBos taurus miR-19b-2 stem-loop
Gene family MIPF0000011; mir-19
Literature search

3 open access papers mention bta-mir-19b-2
(11 sentences)

Stem-loop
   acugcuacu               -   -      uuu    -    g 
5'          uacaguuaguuuugc ugg uuugca   cagc gugu g
            ||||||||||||||| ||| ||||||   |||| ||||  
3'          guguuagucaaaacg acc aaacgu   gucg uaua a
   ---------               u   u      ---    g    u 
Get sequence
Deep sequencing
32728 reads, 387 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 18021338-18021420 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-19b-2
bta-mir-106achrX: 18021857-18021937 [-]
bta-mir-18bchrX: 18021698-18021772 [-]
bta-mir-20bchrX: 18021463-18021531 [-]
bta-mir-19b-2chrX: 18021338-18021420 [-]
bta-mir-92a-2chrX: 18021187-18021254 [-]
bta-mir-363chrX: 18021032-18021105 [-]
Database links

Mature sequence bta-miR-19b

Accession MIMAT0004337
Sequence

56 - 

ugugcaaauccaugcaaaacuga

 - 78

Get sequence
Deep sequencing65402 reads, 76 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).