Stem-loop sequence bta-mir-194-1

AccessionMI0012208 (change log)
DescriptionBos taurus miR-194-1 stem-loop
Gene family MIPF0000055; mir-194
Literature search

6 open access papers mention bta-mir-194-1
(11 sentences)

Stem-loop
   uucuuaac   -        uu         a      g    cu  gc 
5'         ggc gucaucga  guaacagca cuccau ugga  gu  g
           ||| ||||||||  ||||||||| |||||| ||||  ||   
3'         ccg cgguaguu  cauugucgu gaggug accu  ua  u
   ucacuuaa   u        uu         a      -    -u  ac 
Get sequence
Deep sequencing
800452 reads, 5.95e+03 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 24405220-24405316 [-]
antisense
ENSBTAT00000061457 ; IARS2-201; intron 12
Clustered miRNAs
< 10kb from bta-mir-194-1
bta-mir-194bchr16: 24405226-24405310 [+]
bta-mir-194-1chr16: 24405220-24405316 [-]
bta-mir-215chr16: 24404933-24405011 [-]
Database links

Mature sequence bta-miR-194

Accession MIMAT0009254
Sequence

21 - 

uguaacagcaacuccaugugga

 - 42

Get sequence
Deep sequencing1592283 reads, 76 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).