Stem-loop sequence bta-mir-1468

AccessionMI0012207 (change log)
DescriptionBos taurus miR-1468 stem-loop
Gene family MIPF0000777; mir-1468
Literature search

2 open access papers mention bta-mir-1468
(2 sentences)

Stem-loop
   guugaaga        gu  c         c           -----u   c 
5'         ggugggug  uu uccguuugc uguuuugcuga      guu a
           ||||||||  || ||||||||| |||||||||||      ||| u
3'         cuaccuac  aa agguaaacg auaaaacgacu      cag u
   -----caa        uu  a         a           cuuauu   u 
Get sequence
Deep sequencing
77939 reads, 550 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 102956334-102956430 [+]
sense
ENSBTAT00000016923 ; ARHGEF9-201; intron 2
Database links

Mature sequence bta-miR-1468

Accession MIMAT0013592
Sequence

21 - 

cuccguuugccuguuuugcuga

 - 42

Get sequence
Deep sequencing77932 reads, 74 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

References

1
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).