Stem-loop sequence bmo-mir-989a

AccessionMI0012205
Previous IDsbmo-mir-989
DescriptionBombyx mori miR-989 stem-loop
Gene family MIPF0000885; mir-989
Stem-loop
   g       g    a  gg       c     -gu     g  - au 
5'  guucagg uuga au  ccauuac ucaca   cacgu gu c  g
    ||||||| |||| ||  ||||||| |||||   ||||| || |   
3'  uaggucc agcu ug  ggugaug agugu   gugca ca g  a
   a       -    c  aa       c     agu     a  u gu 
Get sequence
Deep sequencing
46 reads, 15.8 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf1898: 14714756-14714846 [-]
intergenic
scaffold4254: 425-515 [+]
intergenic

Mature sequence bmo-miR-989a

Accession MIMAT0012633
Previous IDsbmo-miR-989
Sequence

56 - 

gugugaugugacguaguggaa

 - 76

Get sequence
Deep sequencing30 reads, 2 experiments
Evidence experimental; cloned [1], Illumina [2], RTPCR [3]

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
3
PMID:19823945 "Computational identification and characteristics of novel microRNAs from the silkworm (Bombyx mori L.)" Huang Y, Zou Q, Tang SM, Wang LG, Shen XJ Mol Biol Rep. 37:3171-3176(2010).