Stem-loop sequence bmo-mir-2752

AccessionMI0012204 (change log)
DescriptionBombyx mori miR-2752 stem-loop
Stem-loop
   gg  -a     ---     c  uc    ca     --------   a         - ga        --au    c 
5'   gu  acgcc   gcgga ug  ucaa  cgaug        gcc cggagccgu c  cguccccg    ccag a
     ||  |||||   ||||| ||  ||||  |||||        ||| ||||||||| |  ||||||||    |||| g
3'   ca  ugugg   cgccu ac  aguu  gcugc        cgg gccucggca g  gcaggggu    gguc u
   -g  gg     uac     c  -c    -a     agcgacag   c         u aa        ggcu    c 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004612635.1: 104-242 [+]
intergenic
Database links

Mature sequence bmo-miR-2752

Accession MIMAT0012632
Sequence

20 - 

cucaacacgauggccacgga

 - 39

Get sequence
Evidence experimental; cloned [1], RT-PCR [1]

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).