Stem-loop sequence bmo-mir-306a

AccessionMI0012201 (change log)
Previous IDsbmo-mir-306
DescriptionBombyx mori miR-306a stem-loop
Gene family MIPF0000313; mir-306
Literature search

2 open access papers mention bmo-mir-306a
(19 sentences)

Stem-loop
   cc     agac ga      c g    -  c      u     a       --  g 
5'   gcggg    g  ggcggg g ccgc cu agguac aggug cucugag  ug u
     |||||    |  |||||| | |||| || |||||| ||||| |||||||  ||  
3'   cgccu    c  ccgccu c ggcg ga uccgug uccgc gagacuc  gc g
   -c     -gca ag      - g    c  c      c     c       ug  c 
Get sequence
Deep sequencing
287486 reads, 5.67e+04 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581774.1: 30978-31085 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-306a
bmo-mir-9cNW_004581774.1: 28981-29088 [+]
bmo-mir-306aNW_004581774.1: 30978-31085 [+]
bmo-mir-306bNW_004581774.1: 30994-31069 [-]
bmo-mir-79NW_004581774.1: 31444-31543 [+]
bmo-mir-9bNW_004581774.1: 31448-31537 [-]
Database links

Mature sequence bmo-miR-306a-5p

Accession MIMAT0012629
Previous IDsbmo-miR-306;bmo-miR-306a
Sequence

29 - 

ucagguacuaggugacucuga

 - 49

Get sequence
Deep sequencing287002 reads, 3 experiments
Evidence experimental; cloned [1], RT-PCR [1], Illumina [2], SOLID [3]
Database links

Mature sequence bmo-miR-306a-3p

Accession MIMAT0015303
Previous IDsbmo-miR-306**;bmo-miR-306a*
Sequence

63 - 

cagagccgccucgugccucag

 - 83

Get sequence
Deep sequencing483 reads, 3 experiments
Evidence experimental; Illumina [2], SOLID [3]
Database links

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
3
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).