Stem-loop sequence bmo-mir-9c

AccessionMI0012193
DescriptionBombyx mori miR-9c stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ca   -  - c  -gg            cu          c     g    c  g 
5'   gcg cg c ga   gucgcgggccgu  cuuugguauc uagcu uagg gu c
     ||| || | ||   ||||||||||||  |||||||||| ||||| |||| || g
3'   ugc gc g cu   cagugcucggca  gaagccaugg auuga aucc cg c
   -c   a  u a  aug            uu          u     a    -  g 
Get sequence
Deep sequencing
25107 reads, 8.51e+03 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2839: 28891-28998 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-9c
bmo-mir-9cnscaf2839: 28891-28998 [+]
bmo-mir-306anscaf2839: 30888-30995 [+]
bmo-mir-306bnscaf2839: 30904-30979 [-]
bmo-mir-79nscaf2839: 31354-31453 [+]
bmo-mir-9bnscaf2839: 31358-31447 [-]

Mature sequence bmo-miR-9c-5p

Accession MIMAT0015302
Previous IDsbmo-miR-9c*
Sequence

27 - 

ucuuugguauccuagcug

 - 44

Get sequence
Deep sequencing14122 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence bmo-miR-9c-3p

Accession MIMAT0012621
Previous IDsbmo-miR-9c
Sequence

61 - 

uaaaguuaugguaccgaaguua

 - 82

Get sequence
Deep sequencing9007 reads, 3 experiments
Evidence experimental; cloned [1], RT-PCR [1], Illumina [2]

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).