Stem-loop sequence bmo-mir-9c

AccessionMI0012193 (change log)
DescriptionBombyx mori miR-9c stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ca   -  - c  -gg            cu          c     g    c  g 
5'   gcg cg c ga   gucgcgggccgu  cuuugguauc uagcu uagg gu c
     ||| || | ||   ||||||||||||  |||||||||| ||||| |||| || g
3'   ugc gc g cu   cagugcucggca  gaagccaugg auuga aucc cg c
   -c   a  u a  aug            uu          u     a    -  g 
Get sequence
Deep sequencing
22750 reads, 3.93e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581774.1: 28981-29088 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-9c
bmo-mir-9cNW_004581774.1: 28981-29088 [+]
bmo-mir-306aNW_004581774.1: 30978-31085 [+]
bmo-mir-306bNW_004581774.1: 30994-31069 [-]
bmo-mir-79NW_004581774.1: 31444-31543 [+]
bmo-mir-9bNW_004581774.1: 31448-31537 [-]
Database links

Mature sequence bmo-miR-9c-5p

Accession MIMAT0015302
Previous IDsbmo-miR-9c*
Sequence

27 - 

ucuuugguauccuagcug

 - 44

Get sequence
Deep sequencing12546 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence bmo-miR-9c-3p

Accession MIMAT0012621
Previous IDsbmo-miR-9c
Sequence

61 - 

uaaaguuaugguaccgaaguua

 - 82

Get sequence
Deep sequencing10182 reads, 3 experiments
Evidence experimental; cloned [1], RT-PCR [1], Illumina [2]
Database links

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).