Stem-loop sequence bmo-mir-2733b-1

AccessionMI0012190 (change log)
Previous IDsbmo-mir-2733b
DescriptionBombyx mori miR-2733b-1 stem-loop
Gene family MIPF0000766; mir-2733
Literature search

1 open access papers mention bmo-mir-2733b-1
(4 sentences)

Stem-loop
   uc      a            a u      u    -u     
5'   ucucua uauagucaucac c cucagu gaua  gugu 
     |||||| |||||||||||| | |||||| ||||  ||| a
3'   agagau guguuaguagug g ggguca cuau  uaca 
   -u      g            c u      -    cu     
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581684.1: 346939-347018 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2733b-1
bmo-mir-9dNW_004581684.1: 354559-354643 [-]
bmo-mir-2733cNW_004581684.1: 353724-353805 [-]
bmo-mir-2733gNW_004581684.1: 347847-347958 [-]
bmo-mir-2733a-1NW_004581684.1: 347677-347760 [-]
bmo-mir-2851-1NW_004581684.1: 347670-347768 [+]
bmo-mir-2733b-2NW_004581684.1: 347220-347348 [-]
bmo-mir-2733hNW_004581684.1: 347062-347142 [-]
bmo-mir-2733b-1NW_004581684.1: 346939-347018 [-]
bmo-mir-2733a-3NW_004581684.1: 346598-346745 [-]
bmo-mir-2851-2NW_004581684.1: 346562-346660 [+]
bmo-mir-2733a-2NW_004581684.1: 346489-346605 [-]
bmo-mir-2733fNW_004581684.1: 346080-346197 [-]
bmo-mir-2733iNW_004581684.1: 344891-344998 [-]
bmo-mir-2733e-1NW_004581684.1: 342896-342993 [-]
bmo-mir-2733e-2NW_004581684.1: 342566-342664 [-]
Database links

Mature sequence bmo-miR-2733b

Accession MIMAT0013777
Sequence

50 - 

ucacugggugcgugaugauugu

 - 71

Get sequence
Deep sequencing14 reads, 2 experiments
Evidence experimental; SOLID [1]

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).
2
PMID:20089182 "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R BMC Genomics. 11:52(2010).