Stem-loop sequence hsv1-mir-H8

Accession MI0012168
Previous IDs hsv1-miR-H8
Description Herpes Simplex Virus 1 miR-H8 stem-loop
Stem-loop
-gucc              u a      u   caccc 
     cuguauauauaggg c gggggu ccg     c
     |||||||||||||| | |||||| |||      
     gauauauauguccc g cccccg ggu     c
cuguu              u g      c   acaau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hsv1-miR-H8-5p

Accession MIMAT0012597
Previous IDs hsv1-miR-H8
Sequence

10 - 

uauauagggucaggggguuc

 - 29

Get sequence
Evidence experimental; Solexa [19656888,20181707]

Mature sequence hsv1-miR-H8-3p

Accession MIMAT0012598
Previous IDs hsv1-miR-H8*
Sequence

48 - 

gcccccggucccuguauaua

 - 67

Get sequence
Evidence experimental; Solexa [19656888]

References

1
PMID:19656888 "Analysis of human alphaherpesvirus microRNA expression in latently infected human trigeminal ganglia" Umbach JL, Nagel MA, Cohrs RJ, Gilden DH, Cullen BR J Virol. 83:10677-10683(2009).
2
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).