Stem-loop sequence hsv1-mir-H7

Accession MI0012167
Previous IDs hsv1-miR-H7
Description Herpes Simplex Virus 1 miR-H7 stem-loop
Gene family MIPF0000929; mir-H7
Stem-loop
--             aa       u caa       -   uc 
  gaagaggggggag  agggguc g   ccaaagg ugg  u
  |||||||||||||  ||||||| |   ||||||| |||  g
  cuucucccuucuu  uccccag c   gguuucc gcc  g
cu             -c       c cua       u   ug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hsv1-miR-H7-5p

Accession MIMAT0012595
Previous IDs hsv1-miR-H7
Sequence

14 - 

aaaggggucugcaaccaaagg

 - 34

Get sequence
Evidence experimental; Solexa [19656888,20181707]

Mature sequence hsv1-miR-H7-3p

Accession MIMAT0012596
Previous IDs hsv1-miR-H7*
Sequence

51 - 

uuuggaucccgaccccucuuc

 - 71

Get sequence
Evidence experimental; Solexa [19656888]

References

1
PMID:19656888 "Analysis of human alphaherpesvirus microRNA expression in latently infected human trigeminal ganglia" Umbach JL, Nagel MA, Cohrs RJ, Gilden DH, Cullen BR J Virol. 83:10677-10683(2009).
2
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).