Stem-loop sequence cte-mir-2709

AccessionMI0012156 (change log)
DescriptionCapitella teleta miR-2709 stem-loop
Stem-loop
   cucu    u ug  u           --u     a 
5'     aaug u  aa uagcugugaug   gcuuu g
       |||| |  || |||||||||||   ||||| u
3'     uuac a  uu aucgacacuau   ugaag u
   -auu    u gu  u           ucu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB311706.1: 29082-29151 [-]
intergenic
Clustered miRNAs
< 10kb from cte-mir-2709
cte-mir-2e-2KB311706.1: 29343-29442 [-]
cte-mir-2d-2KB311706.1: 29229-29328 [-]
cte-mir-2709KB311706.1: 29082-29151 [-]
cte-mir-2fKB311706.1: 28946-29028 [-]
Database links

Mature sequence cte-miR-2709

Accession MIMAT0013578
Sequence

7 - 

uguuugaauuagcugugaugug

 - 28

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755470 "MicroRNAs resolve an apparent conflict between annelid systematics and their fossil record" Sperling EA, Vinther J, Moy VN, Wheeler BM, Semon M, Briggs DE, Peterson KJ Proc Biol Sci. 276:4315-4322(2009).