Stem-loop sequence cte-mir-2g

AccessionMI0012140 (change log)
DescriptionCapitella teleta miR-2g stem-loop
Stem-loop
   ugu   -    u   c c     c    -           cu 
5'    gca uggc cac g ggucu agcg ucuguggugcg  g
      ||| |||| ||| | ||||| |||| |||||||||||  a
3'    ugu gucg gug c cuagg ucgc agacacuaugc  a
   uag   u    c   a a     u    c           uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB312122.1: 10157-10241 [+]
intergenic
Clustered miRNAs
< 10kb from cte-mir-2g
cte-mir-71KB312122.1: 9913-10013 [+]
cte-mir-2bKB312122.1: 10029-10129 [+]
cte-mir-2gKB312122.1: 10157-10241 [+]
cte-mir-2cKB312122.1: 10390-10490 [+]
cte-mir-2aKB312122.1: 10534-10634 [+]
Database links

Mature sequence cte-miR-2g

Accession MIMAT0013559
Sequence

48 - 

uaucacagaccgcuuggaucaca

 - 70

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755470 "MicroRNAs resolve an apparent conflict between annelid systematics and their fossil record" Sperling EA, Vinther J, Moy VN, Wheeler BM, Semon M, Briggs DE, Peterson KJ Proc Biol Sci. 276:4315-4322(2009).