Stem-loop sequence cte-mir-2720

AccessionMI0012136 (change log)
DescriptionCapitella teleta miR-2720 stem-loop
Stem-loop
   cu      c g    uc       u g      ac    u a   c  a 
5'   gacugc u ucug  uggguaa c cucuag  caug g ugu gc u
     |||||| | ||||  ||||||| | ||||||  |||| | ||| || g
3'   cugaug a agac  acucauu g gagauc  guac c gcg cg c
   cu      - g    cu       u a      -a    u -   a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB305766.1: 146207-146304 [+]
intergenic
Clustered miRNAs
< 10kb from cte-mir-2720
cte-mir-996KB305766.1: 145992-146064 [+]
cte-mir-2720KB305766.1: 146207-146304 [+]
Database links

Mature sequence cte-miR-2720-5p

Accession MIMAT0013554
Previous IDscte-miR-2720*
Sequence

17 - 

cuggguaaucgcucuagaccau

 - 38

Get sequence
Evidence experimental; 454 [1]

Mature sequence cte-miR-2720-3p

Accession MIMAT0013555
Previous IDscte-miR-2720
Sequence

64 - 

ugacuagagaguuuacucaucc

 - 85

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755470 "MicroRNAs resolve an apparent conflict between annelid systematics and their fossil record" Sperling EA, Vinther J, Moy VN, Wheeler BM, Semon M, Briggs DE, Peterson KJ Proc Biol Sci. 276:4315-4322(2009).