Stem-loop sequence cte-mir-996

AccessionMI0012134 (change log)
DescriptionCapitella teleta miR-996 stem-loop
Stem-loop
   auu                c        g    u u 
5'    ggcggaggcgggugug ugucuggu cgug g u
      |||||||||||||||| |||||||| |||| | u
3'    ccgucucugcuuacac auagauca guac c c
   ucu                a        -    - a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB305766.1: 145992-146064 [+]
intergenic
Clustered miRNAs
< 10kb from cte-mir-996
cte-mir-996KB305766.1: 145992-146064 [+]
cte-mir-2720KB305766.1: 146207-146304 [+]
Database links

Mature sequence cte-miR-996

Accession MIMAT0013552
Sequence

44 - 

ugacuagauaacacauucgucu

 - 65

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755470 "MicroRNAs resolve an apparent conflict between annelid systematics and their fossil record" Sperling EA, Vinther J, Moy VN, Wheeler BM, Semon M, Briggs DE, Peterson KJ Proc Biol Sci. 276:4315-4322(2009).