Stem-loop sequence cte-mir-2f

AccessionMI0012114 (change log)
DescriptionCapitella teleta miR-2f stem-loop
Stem-loop
   uuu        c    u   g    uu        -    ug 
5'    ugagaagu aacc aau cacu  gugaugug cuuu  a
      |||||||| |||| ||| ||||  |||||||| ||||   
3'    auucuuua uugg uua guga  cacuaugc gagg  a
   uac        u    u   g    --        u    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB311706.1: 28946-29028 [-]
intergenic
Clustered miRNAs
< 10kb from cte-mir-2f
cte-mir-2e-2KB311706.1: 29343-29442 [-]
cte-mir-2d-2KB311706.1: 29229-29328 [-]
cte-mir-2709KB311706.1: 29082-29151 [-]
cte-mir-2fKB311706.1: 28946-29028 [-]
Database links

Mature sequence cte-miR-2f

Accession MIMAT0013528
Sequence

53 - 

uaucacaguggauuugguuuau

 - 74

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755470 "MicroRNAs resolve an apparent conflict between annelid systematics and their fossil record" Sperling EA, Vinther J, Moy VN, Wheeler BM, Semon M, Briggs DE, Peterson KJ Proc Biol Sci. 276:4315-4322(2009).