Stem-loop sequence cte-mir-2e-1

AccessionMI0012113 (change log)
Previous IDscte-mir-2e
DescriptionCapitella teleta miR-2e-1 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   gcuugcuuuu  -          c    u    ---              cagu 
5'           gc gaauauucug gcuc gagu   ggcugugauauguu    u
             || |||||||||| |||| ||||   ||||||||||||||     
3'           cg cuuauaagac cggg uucg   cugacacuauacga    g
   ------cucu  u          u    u    uaa              cuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB304652.1: 917-1016 [+]
intergenic
Clustered miRNAs
< 10kb from cte-mir-2e-1
cte-mir-2e-1KB304652.1: 917-1016 [+]
cte-mir-2d-1KB304652.1: 1031-1130 [+]
Database links

Mature sequence cte-miR-2e

Accession MIMAT0013527
Sequence

61 - 

uaucacagucaaugcuuugggcuc

 - 84

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755470 "MicroRNAs resolve an apparent conflict between annelid systematics and their fossil record" Sperling EA, Vinther J, Moy VN, Wheeler BM, Semon M, Briggs DE, Peterson KJ Proc Biol Sci. 276:4315-4322(2009).