Stem-loop sequence aqc-MIR535

AccessionMI0012112 (change log)
DescriptionAquilegia caerulea miR535 stem-loop
Gene family MIPF0000136; MIR535
   --                      a  c    u    gcagag 
5'   ugacaacgagagagagcacgcg gu ggca ucau      g
     |||||||||||||||||||||| || |||| ||||      a
3'   acuguugcucucuuucgugcgu ca cugu agua      u
   au                      a  u    c    aauaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aqc-miR535

Accession MIMAT0012594

1 - 


 - 22

Get sequence
Evidence not experimental
