Stem-loop sequence aqc-MIR529

AccessionMI0012110 (change log)
DescriptionAquilegia caerulea miR529 stem-loop
Gene family MIPF0000388; MIR529
Stem-loop
   --     u       ------   u           -          -a    u  uc  cu    a 
5'   agaga gagagau      aug ugacagaagag agagagcaca  ccca ca  ag  aaag g
     ||||| |||||||      ||| ||||||||||| ||||||||||  |||| ||  ||  |||| a
3'   ucucu cucucua      uac acugucuucuc uuucucgugu  gggu gu  uc  uuuc g
   uc     -       aaccac   u           g          ga    u  uu  -u    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aqc-miR529

Accession MIMAT0012592
Sequence

22 - 

agaagagagagagcacaaccc

 - 42

Get sequence
Evidence not experimental

References

1