Stem-loop sequence aqc-MIR396b

AccessionMI0012095 (change log)
DescriptionAquilegia caerulea miR396b stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
   --          u            -   -cg     uac     gu 
5'   uuccacagcu ucuugaacuuuu uau   auaca   ucuua  u
     |||||||||| |||||||||||| |||   |||||   |||||   
3'   agggugucga agaacuugaaaa gua   uaugu   agaau  u
   aa          u            u   aaa     ---     au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aqc-miR396b

Accession MIMAT0012577
Sequence

1 - 

uuccacagcuuucuugaacuu

 - 21

Get sequence
Evidence not experimental

References

1