Stem-loop sequence aqc-MIR396a

AccessionMI0012094 (change log)
DescriptionAquilegia caerulea miR396a stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
   --            c          ugguaaucuaaucuaauacagauaaaauuaagcuug 
5'   uuccacagcuuu uugaacugca                                    u
     |||||||||||| ||||||||||                                     
3'   agggugucgaaa aacuuggcgu                                    u
   aa            u          uuccgcuauauggugguaccgugguacaugaacuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aqc-miR396a

Accession MIMAT0012576
Sequence

1 - 

uuccacagcuuucuugaacug

 - 21

Get sequence
Evidence not experimental

References

1