Stem-loop sequence aqc-MIR172b

Accession

MI0012090

Description

Aquilegia caerulea miR172b stem-loop

Gene family

MIPF0000035; MIR172

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-172_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The mir-172 microRNA is thought to target mRNAs coding for APETALA2-like transcription factors. It has been verified experimentally in the model plant, Arabidopsis thaliana (mouse-ear cress). The mature sequence is excised from the 3' arm of the hairpin.

Stem-loop

--                    a aaa c   -    c       u    uuu   a 
  gugcagcaucauuaagauuc c   c cua agag cuuauga gggu   gau u
  |||||||||||||||||||| |   | ||| |||| ||||||| ||||   |||  
  uacgucguaguaguucuaag g   g gau uuuc ggauauu cuca   cua u
gc                    - gua a   a    a       -    ---   g 

Mature sequence aqc-miR172b

• Accession: MIMAT0012572
• Sequence: 86 - ggaaucuugaugaugcugcau - 106
• Evidence: not experimental

References

1. PMID:19699282 "Identification of conserved Aquilegia coerulea microRNAs and their targets" Puzey JR, Kramer EM Gene. 448:46-56(2009).