Stem-loop sequence aqc-MIR171f

AccessionMI0012083 (change log)
DescriptionAquilegia caerulea miR171f stem-loop
Gene family MIPF0000030; MIR171_1
Stem-loop
   --   a      a ug             a     uu     ua 
5'   acg gauauu g  cgguucaauuaga aacag  gcuca  a
     ||| |||||| |  ||||||||||||| |||||  |||||  g
3'   ugc cuauaa c  gccgaguuaauuu uuguu  cgagu  u
   gu   a      c gu             a     -u     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aqc-miR171f

Accession MIMAT0012565
Sequence

62 - 

uaauugagccgugccaauauc

 - 82

Get sequence
Evidence not experimental

References

1