Stem-loop sequence hsa-mir-2682

Accession MI0012063
Description Homo sapiens miR-2682 stem-loop
Stem-loop 
-------ac u       ---      u    c        a   uuc  a     aauc 
         c uccugaa   agaggu gggg aggcagug cug   ag cgucc    u
         | |||||||   |||||| |||| |||||||| |||   || |||||     
         g aggauuu   ucuccg cccu ucugucgc gac   uc gcagg    c
aaacucuga c       ccg      u    -        -   uuc  c     guuu
Get sequence
Deep sequencing
67 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 98510798-98510907 [-]
sense
OTTHUMT00000029636 ; RP4-672J20.2-001; exon 1
OTTHUMT00000029636 ; RP4-672J20.2-001; exon 1
OTTHUMT00000029636 ; RP4-672J20.2-001; exon 1
OTTHUMT00000029437 ; RP11-490G2.1-001; intron 3
OTTHUMT00000029437 ; RP11-490G2.1-001; intron 3
OTTHUMT00000029437 ; RP11-490G2.1-001; intron 3
ENST00000413670 ; RP4-672J20.2-001; exon 1
ENST00000538428 ; RP4-672J20.2-201; exon 1
ENST00000413670 ; MIR2682-001; exon 1
ENST00000538428 ; MIR2682-201; exon 1
ENST00000413670 ; MIR2682-001; exon 1
ENST00000538428 ; MIR2682-201; exon 1
ENST00000424528 ; RP11-490G2.1-001; intron 3
ENST00000424528 ; MIR137HG-001; intron 3
ENST00000424528 ; MIR137HG-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-2682
hsa-mir-137 chr1: 98511626-98511727 [-]
hsa-mir-2682 chr1: 98510798-98510907 [-]
Database links

Mature sequence hsa-miR-2682-5p

Accession MIMAT0013517
Previous IDs hsa-miR-2682
Sequence

23 -  

caggcagugacuguucagacguc

 - 45

Get sequence
Deep sequencing 60 reads, 2 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

Mature sequence hsa-miR-2682-3p

Accession MIMAT0013518
Previous IDs hsa-miR-2682*
Sequence

60 -  

cgccucuucagcgcugucuucc

 - 81

Get sequence
Deep sequencing 7 reads, 2 experiments
Evidence experimental; Solexa [2]
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).