|
miRBase |
|
Stem-loop sequence hsa-mir-2681 |
|||||
| Accession | MI0012062 | ||||
| Description | Homo sapiens miR-2681 stem-loop | ||||
| Stem-loop |
----gcccccuu c c g g cccaa uuca gcauuuguguuuuacca cucca ga acug a |||| ||||||||||||||||| ||||| || |||| g aagu cguagacacgaaauggu gaggu cu ugac a gugcaacuuaau a u a a uucuc |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-2681-5p |
|
| Accession | MIMAT0013515 |
| Previous IDs | hsa-miR-2681* |
| Sequence |
22 - guuuuaccaccuccaggagacu - 43 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-2681-3p |
|
| Accession | MIMAT0013516 |
| Previous IDs | hsa-miR-2681 |
| Sequence |
61 - uaucauggaguugguaaagcac - 82 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|