Stem-loop sequence mtr-MIR2652i

AccessionMI0011979 (change log)
DescriptionMedicago truncatula miR2652i stem-loop
Gene family MIPF0000819; MIR2652
Stem-loop
   g                 a                         c             --g    acaacucacagaaaccauuuccacaguaaaaugguuuuggcauaauuggguug 
5'  cgguuauggugcauaag aaauccuuaugcacccugcauaaau cagaaaugguuuu   gagu                                                     g
    ||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||   ||||                                                      
3'  gccaauaccacguauuc uuuaggaauacgugggacguauuua gucuuuaccaaaa   cuca                                                     g
   -                 c                         a             aca    acaugaaguuuugguaaucuacaugaauuacuaaaggucguggaacguauuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 21529035-21529269 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2652i
mtr-MIR2652ichr6: 21529035-21529269 [+]
mtr-MIR399mchr6: 21530943-21531027 [-]
mtr-MIR399mchr6: 21570754-21570838 [-]
Database links

Mature sequence mtr-miR2652i

Accession MIMAT0013432
Sequence

196 - 

uaugcagggugcauaaggauu

 - 216

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).