Dead miRNA entry

miRNA accession:
MI0011906
miRNA ID:
mtr-MIR2111d
Forward to:
MI0011843
Comment:
The MIR2111 loci in miRBase 19 overlap in the Mt3.5.2 genome assembly. The entries are rationalised and merged in miRBase 20, leading to several entries being renamed.

Previous miRNA entry

Stem-loop sequence mtr-MIR2111d

AccessionMI0011906 (change log)
DescriptionMedicago truncatula miR2111d stem-loop
Stem-loop
   ggauuacaacaauacuugcauugua     u   ug    u  a    ca  u   uuaau  -     c  aa    cuu 
5'                          ucuag ccu  ggau ca auua  uu ucc     ac caaua ua  caca   a
                            ||||| |||  |||| || ||||  || |||     || ||||| ||  ||||   u
3'                          agauu gga  ccua gu uaau  ga agg     ug guuau au  gugu   u
   --------uuaaugcgucgacaaua     u   gu    c  c    ag  u   ---uu  a     -  ag    aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 16685914-16686016 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2111d
mtr-MIR2111bchr7: 16691057-16691162 [-]
mtr-MIR2111cchr7: 16686087-16686193 [-]
mtr-MIR2111dchr7: 16685914-16686016 [-]
mtr-MIR2111echr7: 16678770-16678875 [-]
Database links

Mature sequence mtr-miR2111d

Accession MIMAT0013359
Sequence

113 - 

auaaucugcauccugagguuu

 - 133

Get sequence
Evidence experimental;