Dead miRNA entry

miRNA accession:
MI0011835
miRNA ID:
mtr-MIR2111g
Forward to:
MI0011841
Comment:
The MIR2111 loci in miRBase 19 overlap in the Mt3.5.2 genome assembly. The entries are rationalised and merged in miRBase 20, leading to several entries being renamed.

Previous miRNA entry

Stem-loop sequence mtr-MIR2111g

AccessionMI0011835 (change log)
DescriptionMedicago truncatula miR2111g stem-loop
Stem-loop
   a  ug -gu   c   --u                  a      uu    auca      cagaauaaugaaaucaaauugauggcuucuauu 
5'  au  c   aau guu   cuaagccucggagugcgg uuaucu  uccu    ccaaug                                 u
    ||  |   ||| |||   |||||||||||||||||| ||||||  ||||    ||||||                                  
3'  ua  g   uua uaa   gauuuggagucuuacguc aauaga  agga    gguuau                                 u
   c  gu auu   -   ugu                  c      uu    -aug      aaauaagauugagguaguauacuccuguauauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 16661325-16661456 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2111g
mtr-MIR2111gchr7: 16661325-16661456 [-]
mtr-MIR2111hchr7: 16655725-16655830 [-]
Database links

Mature sequence mtr-miR2111g-3p

Accession MIMAT0013288
Sequence

20 - 

aagccucggagugcggauuau

 - 40

Get sequence
Evidence experimental; 454 [1]