Stem-loop sequence dsi-mir-983a

AccessionMI0011791 (change log)
Previous IDsdsi-mir-983
DescriptionDrosophila simulans miR-983 stem-loop
Gene family MIPF0000450; mir-983
Stem-loop
   -     uu  -aua   uauc           ua         uu     a     uuuu 
5'  uugcu  gc    uga    uugcaguaauu  guaauaccu  cgaac cauga    c
    |||||  ||    |||    |||||||||||  |||||||||  ||||| |||||    a
3'  ggcgg  cg    acu    aauguuauuga  uauuaugga  gcuug guacu    g
   a     -u  cuca   uaca           uc         cu     a     uacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chrX: 3277334-3277453 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-983a
dsi-mir-983bchrX: 3277365-3277423 [+]
dsi-mir-983achrX: 3277334-3277453 [-]
dsi-mir-303chrX: 3275250-3275335 [-]
dsi-mir-982achrX: 3274561-3274652 [-]
dsi-mir-2582achrX: 3274401-3274516 [-]
dsi-mir-982bchrX: 3273921-3274024 [-]
dsi-mir-2582bchrX: 3273790-3273868 [-]
dsi-mir-982cchrX: 3273520-3273624 [-]
Database links

Mature sequence dsi-miR-983a-5p

Accession MIMAT0012525
Previous IDsdsi-miR-983-5p
Sequence

32 - 

aguaauaccuuucgaacacauga

 - 54

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence dsi-miR-983a-3p

Accession MIMAT0012526
Previous IDsdsi-miR-983-3p
Sequence

68 - 

augaguucgucagguauuaucua

 - 90

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).