Stem-loop sequence dsi-mir-2582b

AccessionMI0011790 (change log)
DescriptionDrosophila simulans miR-2582b stem-loop
Gene family MIPF0000870; mir-2582
Stem-loop
   a    u      c g              u   c   -  u 
5'  ccau cauauc u gagaguguucuuaa agu ugu ua u
    |||| |||||| | |||||||||||||| ||| ||| ||  
3'  ggua guauag a cuuucauaaggguu uca aca au a
   -    -      - g              -   a   c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chrX: 3273790-3273868 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-2582b
dsi-mir-983bchrX: 3277365-3277423 [+]
dsi-mir-983achrX: 3277334-3277453 [-]
dsi-mir-303chrX: 3275250-3275335 [-]
dsi-mir-982achrX: 3274561-3274652 [-]
dsi-mir-2582achrX: 3274401-3274516 [-]
dsi-mir-982bchrX: 3273921-3274024 [-]
dsi-mir-2582bchrX: 3273790-3273868 [-]
dsi-mir-982cchrX: 3273520-3273624 [-]
Database links

Mature sequence dsi-miR-2582b-5p

Accession MIMAT0012523
Previous IDsdsi-miR-2582b*
Sequence

14 - 

uggagaguguucuuaauagucu

 - 35

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence dsi-miR-2582b-3p

Accession MIMAT0012524
Previous IDsdsi-miR-2582b
Sequence

49 - 

aaacuuugggaauacuuucgag

 - 70

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).