Stem-loop sequence dsi-mir-982a

AccessionMI0011784 (change log)
DescriptionDrosophila simulans miR-982a stem-loop
Gene family MIPF0000843; mir-982
Stem-loop
   c        gcu  a   uu   a    u       a    auuuu 
5'  gaaaucau   ag uca  aac agua cauguaa uuga     u
    ||||||||   || |||  ||| |||| ||||||| ||||     g
3'  uuuuggua   uc agu  uug uuau guacauu aacu     u
   -        -au  a   uc   c    u       -    auaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chrX: 3274561-3274652 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-982a
dsi-mir-983bchrX: 3277365-3277423 [+]
dsi-mir-983achrX: 3277334-3277453 [-]
dsi-mir-303chrX: 3275250-3275335 [-]
dsi-mir-982achrX: 3274561-3274652 [-]
dsi-mir-2582achrX: 3274401-3274516 [-]
dsi-mir-982bchrX: 3273921-3274024 [-]
dsi-mir-2582bchrX: 3273790-3273868 [-]
dsi-mir-982cchrX: 3273520-3273624 [-]
Database links

Mature sequence dsi-miR-982a-5p

Accession MIMAT0012515
Sequence

19 - 

uuaacaaguaucauguaaauugaa

 - 42

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence dsi-miR-982a-3p

Accession MIMAT0037361
Sequence

57 - 

aauuacauguuauucguucuug

 - 78

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).