Stem-loop sequence dsi-mir-978b

AccessionMI0011774 (change log)
Previous IDsdsi-mir-978-as
DescriptionDrosophila simulans miR-978b stem-loop
Stem-loop
   -   ucca     -       a    g      -ac   auucuc 
5'  gcg    cacaa cugcaau uacg cacugg   acg      g
    |||    ||||| ||||||| |||| ||||||   |||       
3'  cgc    guguu gacguua augc gugacc   ugc      a
   c   ---c     a       g    g      gaa   aacacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dsi-miR-978b-5p

Accession MIMAT0037358
Sequence

19 - 

uauacggcacuggacacgauucucgac

 - 45

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dsi-miR-978b-3p

Accession MIMAT0012503
Previous IDsdsi-miR-978-as
Sequence

53 - 

uaagccaguggcguagauugca

 - 74

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).