Stem-loop sequence dsi-mir-1013

AccessionMI0011770 (change log)
DescriptionDrosophila simulans miR-1013 stem-loop
Gene family MIPF0000985; mir-1013
Stem-loop
   -  accaaa  c  -    -   ggagag        c   c    -a      a  a 
5'  gg      gc ca ccgu gcu      gugaguuu gua acuu  auuaau gg u
    ||      || || |||| |||      |||||||| ||| ||||  |||||| || c
3'  cc      cg gu ggca cgg      cgcucaag cgu ugaa  uaauug cc g
   a  -acuag  c  a    g   -----a        c   a    aa      -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr3R: 26257480-26257587 [-]
intergenic
Database links

Mature sequence dsi-miR-1013

Accession MIMAT0012499
Sequence

65 - 

auaaaaguaugccgaacucgcag

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).