Stem-loop sequence dsi-mir-989

AccessionMI0011768 (change log)
DescriptionDrosophila simulans miR-989 stem-loop
Gene family MIPF0000885; mir-989
Stem-loop
   ----ugccgagauaa        --- ug    uuu      c 
5'                guuucauu   u  cguc   ugaauu g
                  ||||||||   |  ||||   |||||| a
3'                caagguga   a  guag   acuuga a
   acguuaaaguccaua        ugc gu    ugu      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2R: 8799023-8799104 [-]
intergenic
Database links

Mature sequence dsi-miR-989

Accession MIMAT0012497
Sequence

47 - 

ugugaugugacguaguggaaca

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).