Stem-loop sequence dsi-mir-981

AccessionMI0011761 (change log)
DescriptionDrosophila simulans miR-981 stem-loop
Gene family MIPF0000710; mir-981
Stem-loop
   -   ag --auaaaca   u   u aagu          ua          -   uuaa 
5'  cuu  g         ucc cac g    cggguuucgu  gcagcgggcu guu    u
    |||  |         ||| ||| |    ||||||||||  |||||||||| |||    a
3'  gaa  c         agg gug c    guccaaagca  uguugcuuga caa    a
   g   cu gcaacuaaa   u   u guac          gc          a   cuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dsi-miR-981-5p

Accession MIMAT0012485
Previous IDsdsi-miR-981*
Sequence

27 - 

cggguuucguuagcagcgggcu

 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-981-3p

Accession MIMAT0012486
Previous IDsdsi-miR-981
Sequence

69 - 

uucguugucgacgaaaccugc

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).