Stem-loop sequence dsi-mir-969

AccessionMI0011758 (change log)
DescriptionDrosophila simulans miR-969 stem-loop
Gene family MIPF0000879; mir-969
Stem-loop
       cccca   -c           uc       c  uaag        gagaucgu 
5' gaau     agu  ucuguccuacg  cgaguuc ac    caaguuuu        u
   ||||     |||  |||||||||||  ||||||| ||    ||||||||         
3' cuua     uca  agguagggugc  gcucgag ug    guucaaaa        u
       --acg   uc           uu       u  caca        acaaaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dsi-miR-969-5p

Accession MIMAT0012479
Previous IDsdsi-miR-969*
Sequence

28 - 

gaguuccacuaagcaaguuuu

 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-969-3p

Accession MIMAT0012480
Previous IDsdsi-miR-969
Sequence

69 - 

aacuugacacguugagcucgu

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).