Stem-loop sequence dsi-mir-252

AccessionMI0011751 (change log)
DescriptionDrosophila simulans miR-252 stem-loop
Gene family MIPF0000285; mir-252
Stem-loop
   u  gcc  cu   ua  aaguuc     cc        a u  c       uuag   -  u 
5'  gu   gu  acu  cc      gcuuu  uaaguacu g gc gcaggag    guu cg g
    ||   ||  |||  ||      |||||  |||||||| | || |||||||    ||| ||  
3'  cg   cg  uga  gg      cgaaa  auucguga c cg cguccuc    uaa gc u
   a  acc  -u   gc  ------     uu        a c  u       --ca   c  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dsi-miR-252-5p

Accession MIMAT0012465
Previous IDsdsi-miR-252
Sequence

30 - 

cuaaguacuagugccgcaggag

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-252-3p

Accession MIMAT0012466
Previous IDsdsi-miR-252*
Sequence

74 - 

uccugcugcccaagugcuuauua

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).