Stem-loop sequence dsi-mir-1010

AccessionMI0011750 (change log)
DescriptionDrosophila simulans miR-1010 stem-loop
Gene family MIPF0000866; mir-1010
Stem-loop
   -   ca    --ua     -   caacgg        ---u    a        auuua       u 
5'  aca  uccg    uucgu gcu      guaagugg    guag ugaaacaa     ccaacaa a
    |||  ||||    ||||| |||      ||||||||    |||| ||||||||     ||||||| u
3'  ugu  aggu    gagca cga      cguuuacc    uauc acuuuguu     gguuguu u
   u   ca    ccag     u   ------        uugc    c        ----a       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr3R: 17925959-17926078 [+]
intergenic
Database links

Mature sequence dsi-miR-1010-5p

Accession MIMAT0012463
Previous IDsdsi-miR-1010*
Sequence

26 - 

guaagugguguagaugaaaca

 - 46

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-1010-3p

Accession MIMAT0012464
Previous IDsdsi-miR-1010
Sequence

76 - 

uuucaccuaucguuccauuugcag

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).