Stem-loop sequence dsi-mir-993

AccessionMI0011749 (change log)
DescriptionDrosophila simulans miR-993 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   -  -   -    cc    c     uuc          ----uuuaaa     -      g 
5'  cu ccc guga  uacc uguag   cgggcuuuug          uggcg uucggc c
    || ||| ||||  |||| |||||   ||||||||||          ||||| |||||| a
3'  ga ggg cacu  augg acauc   gcucgaagac          gucgu aggcug u
   a  u   a    cu    -     ucu          uauuagcucg     u      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr3R: 2632935-2633048 [+]
intergenic
Database links

Mature sequence dsi-miR-993-5p

Accession MIMAT0012461
Previous IDsdsi-miR-993*
Sequence

11 - 

cuacccuguaguuccgggcuuuug

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-993-3p

Accession MIMAT0012462
Previous IDsdsi-miR-993
Sequence

81 - 

gaagcucgucucuacagguaucu

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).