Stem-loop sequence dsi-mir-193

AccessionMI0011744 (change log)
DescriptionDrosophila simulans miR-193 stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
     g    -----   c c       g         uu   au   c  -----------u   u   a 
5' cc ugug     ugc c cauuaug uugggauuu  uag  cag ag            uau gcu u
   || ||||     ||| | ||||||| |||||||||  |||  ||| ||            ||| |||  
3' gg acac     aug g guaauac aacccugaa  auc  guc uc            aua cga a
     -    caaaa   a a       -         uc   cg   a  uucuaaauauuu   c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr3L: 20903317-20903436 [+]
intergenic
Database links

Mature sequence dsi-miR-193-5p

Accession MIMAT0012451
Previous IDsdsi-miR-193*
Sequence

23 - 

ugggauuuuuuagaucagcagu

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-193-3p

Accession MIMAT0012452
Previous IDsdsi-miR-193
Sequence

76 - 

uacuggccuacuaagucccaac

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).