Stem-loop sequence dsi-mir-190

AccessionMI0011743 (change log)
DescriptionDrosophila simulans miR-190 stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   -  u   uc      -            au      u  uau auu 
5'  ga ggu  caguga gauauguuugau  ucuugg ug   c   c
    || |||  |||||| ||||||||||||  |||||| ||   |    
3'  cu cca  gucauu uuauacaaacua  aggacc ac   g   a
   g  c   gu      a            --      c  -uu aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr3L: 8005923-8006011 [+]
intergenic
Database links

Mature sequence dsi-miR-190-5p

Accession MIMAT0012449
Previous IDsdsi-miR-190*
Sequence

14 - 

agauauguuugauauucuugguug

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-190-3p

Accession MIMAT0012450
Previous IDsdsi-miR-190
Sequence

55 - 

cccaggaaucaaacauauuauua

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).