Stem-loop sequence dsi-mir-955

AccessionMI0011742 (change log)
DescriptionDrosophila simulans miR-955 stem-loop
Gene family MIPF0000989; mir-955
Stem-loop
        ---   ---gcc   ua    a   c              u      ccugu uu 
5' ucuuu   uug      agc  auca cuc aucgugcagagguu gagugu     g  u
   |||||   |||      |||  |||| ||| |||||||||||||| ||||||     |   
3' agaaa   aac      ucg  uggu gag uggcacgucuuuaa cuuacg     c  u
        ucc   aaagau   ca    a   a              -      cuaau cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr3L: 2834569-2834683 [+]
intergenic
Database links

Mature sequence dsi-miR-955-5p

Accession MIMAT0012447
Previous IDsdsi-miR-955
Sequence

25 - 

caucgugcagagguuugaguguc

 - 47

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-955-3p

Accession MIMAT0012448
Previous IDsdsi-miR-955*
Sequence

66 - 

cauucaauuucugcacgguaga

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).