Stem-loop sequence dsi-mir-968

AccessionMI0011739 (change log)
DescriptionDrosophila simulans miR-968 stem-loop
Gene family MIPF0000865; mir-968
Stem-loop
   -   uuca  ga  c     u        uc       g     uucucaa 
5'  uug    ug  ag uuccu aaguagua  cauuaaa gguug       c
    |||    ||  || ||||| ||||||||  ||||||| |||||        
3'  aac    ac  uc aagga uucaucau  guaguuu ccaac       a
   a   --ug  -a  u     u        --       g     uaaacgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2L: 13506683-13506780 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-968
dsi-mir-968chr2L: 13506683-13506780 [-]
dsi-mir-1002chr2L: 13506522-13506624 [-]
Database links

Mature sequence dsi-miR-968-5p

Accession MIMAT0012441
Previous IDsdsi-miR-968
Sequence

20 - 

uaaguaguauccauuaaaggguug

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-968-3p

Accession MIMAT0012442
Previous IDsdsi-miR-968*
Sequence

62 - 

accguuugauguacuacuuuag

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).